Is it fair to blame investment bankers for the global downturn? Essay

It seems to be quite easy to jump on the ‘bank-wagon’ and blame investment bankers for the current global economical downturn. The current downturn in question is one which is generally accepted by the financial industry to have started in 2007, and was officially dated December 2007 by the National Bureau of Economic Research (NBER).The question is, whether this industry and its bankers are the root cause, and if so, could they have avoided it? The word ‘bankers’ can imply different meanings to different people, so to clarify, when I use the word ‘bankers’ in this text, I am referring to investment bankers. The first article I analysed is by Jonathan Wang, Ph.D., and entitled ‘Real Causes For US Financial Meltdown and Global Recession’ (March 2009). Wang is the President of Amlink, a multi-million dollar company which provides links in trade and politics between China and the United States of America (USA). He is based in Michigan, USA. I will be comparing it to John Gapper’s ‘Promises that proved ultimately empty’ (January 9th 2012)[1]. Gapper is the assistant editor and chief business commentator for the Financial Times newspaper and website. He is based in New York, USA. Wang has an opinion that the bankers are unaccountable as the blame is with the governments whereas Gapper has an antipodal view in line with the assessment Wang gave, stating ‘it was within banks where the crisis emerged and where its heart still lies’. Wang seems to have a widespread knowledge of many fields. He has a Ph.D in geosciences from the University of Michigan. Geosciences have no relevance to economist articles on the banking industry but this Ph.D allowed him the expertise to start Amlink a year later, as he originally focused on importing and exporting high quality marble between US and China. He increased his links with the two countries by giving financial & trade advice (business consulting), intervening in politics, research & development, manufacturing and IT services. This how we gained his expertise. This expertise of 19 years strengthens his perspective as he has gained the relevant knowledge and skills to talk about this topic with credibility. However, his trade is between (mainly) US and China thus may so it is questionable to whether his experience can be applied to Europe, where many economies collapsed, such as Greece. Gapper currently works for the Financial Times (FT) since 1987, an international daily broadsheet newspaper and website, available in 24 countries. They have a daily readership of 2.1 million and 5.7 million online subscribers. His position is associate editor and chief business commentator. He was trained by the Mirror Group and worked for the Daily Mirror, Daily Mail & Daily Telegraph newspapers in the United Kingdom. Additionally, he has worked as columnist for the BBC, UK & Worldwide. His resume also lists New York Magazine, CNBC & CNN among his employers. This striking list of employers may show, at first glance, that he is not politically bias possibly leading him to be known as a highly reputable columnist. the Conservative Party, one that is centre-right; The Daily Mail is also a Conservative supporter; and However, his political stance may be more Conservative as the FT is a public supporter of the Daily Telegraph has been nicknamed the ‘Torygraph’ due to its support of the Conservative party. He has previously worked for politically independent media but his main contract of employment has been with FT since 1987. This political bias may narrow his perspective. Additionally, in 2011, he won four awards in multiple countries. In the United States he was awarded the Best Columnist Citation by the Society of American Business Editors & Writers; and in the UK he was award with the Best Business Columnist at the Comment Awards. He also has a degree in Philosophy, Politics and Economics from Oxford University. Both articles have strengths and weaknesses, and it is better to analyse these sections rather than attacking the author (ad hominem). The chain of argument in both articles has been constructed quite rigidly, and allows the statements made by the respective authors to reach their necessary conclusions. Wang concludes that increasing tax on the top income groups becomes necessary as the government must focus on stabilization rather than expansion. His main reasoning for this is ‘when the share of total income going to [the] top 10% reached 50%, the capital market crashed in the United States’. He also has an intermediate conclusion that the ‘Government’s improper interventions in the capital market before both episodes of crisis had accelerated the extreme inequalities and ultimately intensified the crisis.’ Wang reasons that ‘It is the extreme inequality that has resulted in the great depression in 1929 and again caused the global recession today’. This is fallacy of the single cause as the recession in 1929 has three are three general theories on what caused the 1929 depression, Keynesian, Monetarist & Austrian. None of these theories are based on inequality. The Monetarist view blamed the Federal Reserve for ignoring the importance of money, who themselves agreed with this and apologised on the 8th of November 2002 via Chairman Ben Bernanke[2]. It may be that the recession is part of the business cycle, and happens quite frequently whereas a depression is a sustained, long term economical downturn. The NBER stated that ‘The expansion [from November 2001 onwards] lasted 73 months’ which then strengthens Wang’s reason that ‘two major economic expansions led to two episodes of extreme inequalities in the United States. Both ended in severe economic depression.’ [3]Elizabeth Allgoewer (2002) states that this was the cause of the Great Depression, however the true cause is still being debated by economists, with around a dozen other heterodox economical theories such as non-debt inflation or population dynamics. His reasoning here needs further clarification or research before this can be fully taken as evidence. Gapper states that ‘driven by the rise of derivatives, the loosening of regulation and capital standards, and a hubristic belief that they had somehow broken their old habit of losing billions of dollars in downturns’. He does not strengthen this with any evidence on the ‘loosening of regulation’ etc., and deserted his statement. He also quotes credible sources such as Ranu Dayal, senior partner at the world’s leading advisor on business structure, the Boston Consulting Group – ‘There is a deep question of legitimacy that banks need to face up to’. However one of his sources is credited as being a Professor but in fact he is only an Associate Professor, a position which still has very high credibility, but of less than the one quoted by Gapper. Also, Gapper does not give any conflicting perspective, the only views you read are the ones that agree with him. This weakens his argument as he has not considered alternative perspectives. After analysing both articles, my view is still similar to Gapper and I already thought that it was fair to blame investment bankers for the 2007 downturn. Whilst I note that they dealt with a lot of money and it was not handled in a correct manner by anybody who had access to it (including the Federal Reserve), I also can see where Wang‘s concept bases its format. His perspective of social inequalities is only US based but I can understand his assumptions that expansion was high and the consequence of this led to social inequalities. This has happened elsewhere, such as during the Chinese Mao era of 1949-1976, in particular during the Great Leap Forward (1958-61). Gapper’s perspective has persuaded me that he is of more expertise than Wang as he is so influential in finance media. His analysis was concise and constructive. He quoted many important figures in his article including an executive director of the Bank of England; Chairman of the Financial Services Authority; and a Professor of Entrepreneurship at MIT Sloan school. His arguments are quite strong however he does go a stage of a circular argument where he should be concluding his article. His evidence did strengthen my perspective however Wang’s comments led me to read more into financial theories, especially of those surrounding the 1929 Great Depression. He managed to intrigue me into the history of the financial world and I do believe that 1929 and 2007 are very similar in the cause, but the cause is the banking industry, not the housing market. Wang has only commented on the United States but his views may apply worldwide however his lack of evidence weakens his perspective as it is too narrow. My final conclusion is that investment bankers were the major, not the only, cause of the global downturn which started in 2007, and we have to share the blame for the current economical state

Psychology, IT and Individualism Essay

As information technology continues to develop with more people getting exposed to it, numerous changes are also taking place the field of psychology. Previously, many IT analysts frequently argued that psychology was taking longer than enough to implement and adopt technological advancements. However, recent researches indicate that the practices and methods applied in psychology have greatly transformed as a result of changes in information technology. First, the internet has been one of the major latest trends in psychology; it is highly associated with psychopathology (Wilson 2004). For instance, depression and loneliness have often been connected to the excess use of the internet since it results to addiction. Secondly, there is the use of information technology in counseling and psychotherapy. This is currently being done via the internet; this has resulted to some lack of privacy and confidentiality as well as loss of effectiveness in the practice since some important features such as facial expression and verbal expression has been lost (Wilson 2004). IT is also applied in research and development in psychology to enhance further growth and generation of useful knowledge. For instance, the authors of the current DSM IV-TR applied computerized criteria in revising the classification of disorders in the manual to come with a less flawless criterion of categorizing disorders and disabilities. Using IT, today’s psychotherapists have been able to make numerous improvements in the way through which they can reach, counsel and correspond with their clients (discussed in the next section) (Azucena, Hunter, 2001). The growth of Psychotherapy Psychotherapy refers to private individual counseling by professional psychotherapists. As a highly growing trend in psychology, psychotherapy is used by psychotherapists to assist them in developing deliberate interpersonal relationships with their clients as a strategy for helping the patient to improve their well being. The trend applies many modern techniques of building closer relationships with the patients such as face to face dialogues, home phone calls and regular visits of the therapist to the client (Azucena, Hunter, 2001). This trend is basically aimed at improving the mental health of the patient through interpersonal relationships. This represents a great shift in the nature of counseling psychology, psychiatry, occupational therapy, clinical psychology and other related fields in psychology. In essence, psychotherapy is not a new trend in the field of psychology since over the years, people have received private reassurance and counsel from others; what is new and becoming increasingly famous in psychology is the application of modern and deliberate professional techniques in psychotherapy. Such psychotherapeutic techniques include online counseling whereby a therapist handles client personally through creating client accounts where he can easily relate with the client on one-on-one(but not face-to-face) bases (Tredinnick, Fowers, 1999). Most of the new psychotherapeutic techniques are possible because of the advancements in the use of information technology in the field of psychology as discussed above. For instance, therapists encourage clients to use social networks to be able to communicate easily with them and their families. In addition, they also approve the use of phone calls whereby clients are free to call their physicians at any time of the day so that they can discuss their issues at convenience. However, modern psychotherapy is not without a number of flaws. Recently, concerns have greatly risen concerning the advancement of individualism in psychotherapy (Tredinnick, Fowers, 1999). Psychotherapy encourages individualism on both the therapist and the client. Individualism is a term used in psychology to refer to ways through which people recognize themselves only and concentrate on individual goals as opposed to collectivism. In this sense, psychotherapist no longer view psychotherapy as a collective discipline that require combined efforts with other experts in the field since they are in a position to carry out counseling and psychiatry without involving anybody else—they can visit their clients at home, chat with them online and make home phone class with them. This has resulted to a great decline in the success of psychology as a collective discipline (Tredinnick, Fowers, 1999; Azucena, Hunter, 2001). Conclusion The use IT in psychology and the advancement in psychotherapy are important developments in psychology and should be highly encouraged. However, it is upon therapists and other psychological professionals to ensure that this new trends are used effectively to prevent the decline evident in cooperation among professional bodies in the field of psychology due to individualism. References Azucena, P. G. , Hunter, H. G. (2001) Redefining Therapeutic Success with Virtual Reality Exposure Therapy, Cyber-psychology & Behavior, 4(3), pp. 484-489. Fowers, B. J. , Tredinnick, M. G. (1999). Individualism and psychotherapy; are psychologists leading or following individualistic trends? Counseling, Psychology Quarterly, 12(3): pp. 303-313 Wilson, J. T. et al (2004). Current trends in psychology and the behavioral sciences. University of Pittsburgh press: Pittsburgh, PA.

Quiz Essay Example | Topics and Well Written Essays - 250 words - 7

Quiz - Essay Example he computer screen behind the objective of staying connected to the people online, he does not know that to stay connected online, he is getting disconnected from the world around him, and is getting oblivious of those living around him, who need him and can make him happier than the online community. The social isolation creates adverse effects on the family relationships because online socializing works by dissociating social relationships from physical actuality. Today, we are always connected to the people we know, whether we are sitting on our couch or we are out of town, yet we are suffering from depression, anxiety and loneliness. Today, we are all the time getting updates from our friends, relatives and classmates; and, we do not have to schedule face-to-face meetings in order to stay in each other’s lives. And, all this has been possible thanks to the online social networking websites which offer great fun and mind-engaging applications in addition to letting us find people of our own interests and hobbies. However, this has resulted in people hesitating in interacting with others in the physical world. They are hiding from the bitter events that come with real relationships. They do not want to make commitments with physical world relationships. So, they find a way out in the form of online socializing. They are, however, unaware of the fact that this epidemic of social media will make them socially excluded; and, time will come when they will become totally oblivious to real feelings and

Film Analysis Essay Example | Topics and Well Written Essays - 750 words

Film Analysis - Essay Example The film portrays him as a counterculture individual defining the field of rock and roll of his time. The film’s depiction of Jim Morison goes beyond the iconic traits. He is portrayed as an alcoholic star with interests in the spiritual plane. He indulges in hallucinogenic drugs and has a growing obsession with death. Mise-en-scene The plot of the movie begins with an instance Jim Morison was recording his album, the American Prayer. The scenes quickly shift to years back when Jim Morison was a child. The memory of his family driving along a desert highway crops up. The younger Jim Morison seems like an elderly Native American about to die by the roadside. The movie picks up when Jim Morison arrives in California and he assimilates into Venice Beach culture and joins UCLA to study. He then meets Pamela Couson, his girlfriend. The origin of the Doors begins when Morison meets Ray Manzarek. Later in the film, the audience is introduced to Robby, John Densmore and Krieger. As th e movie progresses, Jim Morison convinces his band mates to take a trip to Death Valley. In the Death Valley, the band experiences the effects of psychedelic drugs. On their return to Los Angeles, the band plays several shows in famous clubs of the time. In particular, their performance at a nightclub Whisky a Go Go earns them a rapid growth of fan base (Stone, 1991). Jim Morison’s occasional improvised lyrics and on-stage antics raise the ire of night club owners. The popularity of the band continues to escalate, nonetheless. The movie does not give viewers the true picture of what made Morrison tick in his age and time. Even though the movie did a lot of staff the right way, the director left out a lot of positive moments in Jim Morrison’s life. Stone concentrated on the ugly moments Jim portrayed miscalculated actions marred with drugs and alcohol. An instant in the plot of the film that does not correspond to the true life of Morrison include the joining of the ban d by Robby Krieger. In the film, the director portrays Morrison as having the full band from the onset. The members included Robby Krieger. In real life, Robby Krieger joined the Door many months after the band began. In addition, Jim asks the bartender for Dos Equis. This was ages before the brand was imported into the United States. The drink was imported into the states for the first time in 1973. While taking a shower with Jim in New Haven, Connecticut, Patricia mentions that Jim attended University of Florida. In real sense, the artist attended Florida State University. Misconception in Characterization Screenplay of the Door is based on real people and events. Even though a number of the episodes explored in the movie are based on the lives of the people, some instances portray the visions of the director and dramatized events. An example of the dramatized events in the movie is the moment Jim is asked to change the lyrics of his famous song, Light my Fire. This special reques t for appearance on the Ed Sullivan Show depicts the artist as a blatant, non yielding individual. The movie depicts the artist as a defiant man, shouting the word â€Å"higher† on TV. In reality, Morrison had shouted the word â€Å"fire† during his lifetime. During his lifetime, Morrison had clarified that the incident was meant to change the lyrics of his song during a live TV performance, but was too nervous to make the change

Reflection Essay Example | Topics and Well Written Essays - 250 words - 41

Reflection - Essay Example In addition, there are various factors cited as limitations to interactional activities within the document. One of the limitation is learners are usually subjected to a scenario where they are engaged with inputs through complicated dimension of language. There are also various dimensions of interaction pointed and elaborated within the document; one of these dimensions is associated with the fact that interact has been perceived as an ideational activity: This entails that there are certain mental awareness that may exist among individuals, thus shaping the manner through, which they think on issues ascribed to the social and physical environment. Another fundamental issue covered within the document is impact of language on teaching. The document asserts that, indeed there are various impacts of language on teaching. One of the impacts is that language enables teachers and tutors to direct and provide appropriate guidance to their students. Consequently, there are micro-strategies that can used to facilitate interaction learning; one of these strategies is holiday shopping, which basically entails facilitated decision-making process among

Sexuality Research Paper Example | Topics and Well Written Essays - 500 words

Sexuality - Research Paper Example But, it is impossible to correctly draw the margin that divides poor from the privileged class. People below a given line of income may be called poor. Many analysts have argued that it is impossible to adjust the poverty threshold over long periods of time using the inflation rate (Consumer Price Index) but that the poverty measure must be reformulated from scratch every so often since what is a necessity’ changes from period to period, from society to society (Hobjin, 2002). According to G. Duncan â€Å"economic conditions in early childhood clearly matter the most and that income effects are nonlinear, with the largest impact associated with increments to very low incomes†. He further states that complete schooling and no marital childbearing are related to parental income during early and middle childhood. This disadvantage suffered by the children of the poor can be overcome if they are given a compulsory education by concerning authorities. Moreover, education should be job oriented. A person could study in an elementary school and still get the right kind of education to help him with his job. The child’s potential should be evaluated and given the kind of education that is suitable to him. If the children of the poor people get the right kind of career oriented education then it will help them in the long run. The poor may not be able to support their kids for higher education. They would need them to help support the family. Hence, t he children of the poor should be given basic education that encompasses trade knowledge. This would benefit the students into becoming a better grade laborer who earns more than his peers. Every human has the right to basic education. It helps get an honest job that produces a decent income necessary to run a family.

Hershey's Sweet Mission Personal Statement Example | Topics and Well Written Essays - 750 words

Hershey's Sweet Mission - Personal Statement Example This paper tells that active listening is a way of listening and responding to another person that improves mutual understanding. Workers that are active listeners are able to communicate better with their colleagues. The new appraisal system must identify traits that are important in the performance of a particular employee. The company will monitor other personality traits of the employee that can impact performance. Diversity can be spread further into a corporate culture giving minority jobs in which they have to perform a supervisory role. Diversity in team activities has the benefit of fostering creativity among team members. Creativity helps workers provide better ideas and alternative solutions. As a Hershey, employee my perspective and motivation would be to comply with the vision and mission of the company. The first value that I would apply in my everyday interactions with my co-workers is teamwork. â€Å"Teamwork occurs when group members work together in ways that utili ze their skill well to accomplish a purpose†. In the corporate environment of the 21st-century, teamwork has become a critical success factor for corporations. Teamwork can help Hershey create an environment of trust and mutual respect. My mentality as a Hershey employee would be to cooperate with my colleagues at all times. Teamwork and cooperation are two desirable work outcomes. I would maintain good communication with my supervisors and with the other employees of the company. The employees of Hershey represent the corporate image of the company. It is important for them to behave properly with the utmost moral values during both their work and personal time. A second trend that is going to impact human resource professionals in the future is an increased dependency on technological tools. One of the HR practices gaining popularity in the work environment of the 21st century is empowerment. â€Å"Empowerment is increasing in popularity because it helps firms reduce their administrative expenses† (Worldbank, 2011). The employees at Hershey would benefit from empowerment because more responsibility will be given to them. The moral of the workers also improves due to the use of empowerment. Hershey is an enterprise with a global workforce. The use of empowerment can help streamline the work and reduce beaurocracy. The motivation of the employees also increases as a consequence of the use of empowerment. Giving greater responsibility to the employees of Hershey should provide valuable work experience to the workers. Empowerment is also beneficial to a company because it frees up a lot of managerial time that can be used in more productive practices such as strategic planning. The use of empowerment also increases employee satisfaction. Employees that are happy at work produce at a higher level. The use of mentoring is an HR practice that can benefit Hershey in a variety of manners. The mentoring relationship is composed of a mentor and a protege. The protege receives training and knowledge from the mentor. The training the mentor provides will help the protege achieve his daily activities for the company. Mentorship is an efficient and cost-effective way to help in the developmental process of an employee. One of the drawbacks of using mentorship to develop the skills and abilities of employees is that the technique is limited to the amount of managerial time at disposal.  

How immigration affect social and economic status of sending and Research Proposal

How immigration affect social and economic status of sending and recieving countries - Research Proposal Example Accordingly, the effects of immigration are demarcated to indicate those affecting the country of origin and those affecting the receiving country. In general, it is evident that immigration has dual effects in the sense that the movement of people from one country to the other affects the sending country on one hand and the host country on the other. Immigration is an imperative dynamic in the international economy (Hall 59). Research estimates indicate that more than 110 million people reside outside their countries of origin. This shows that the aspect of immigration plays a critical position in economic, communal and political lives of many people across the world. People travel away from their nations of birth due to a number of reasons though it is mostly perceived that a majority of immigrants move away from their homes in search for opportunities of employment. It is a clearly established that there are countless economic and social effects of immigrations. In a nutshell the most significant implications of immigrations may include; first and foremost, effects on the host nation’s employment market whereby immigration could cast severe implications on the host countries wages and employment opportunities. Subsequently, immigration could immensely influence the budgetary arrangement of the destination country becaus e the services received by the immigrants including education and health may not strictly balance with the increased taxes from workers (Berg and Bodvarsson 27). Additionally, immigration could offer a credible solution to the problem of aging population in the country of destination. Lastly, immigration may significantly affect the economy of the sending country both positively and negatively though some negative effects could turn around as benefits to the country. For instance, brain drain is a harmful implication of immigration to the country of origin but could end up being a

European Trade Policy Essay Example | Topics and Well Written Essays - 2250 words

European Trade Policy - Essay Example Art. 113 lists a number of measures included in the CCP: tariff rates, conclusion of tariff and trade agreements, uniformity in measures of liberation, export policy and measures to protect trade. Art. 113 is not exclusive, just a list of examples. The EU has interpreted that the CCP "includes the same elements as the external trade policy of a state", meaning that the CCP may include trade regulation, as well as trade liberalization measures and defensive measures against unfair commercial practices. As examples of defensive measures we can mention Anti-dumping Regulation, Illicit Practices Regulation and Counterfeit Regulation. EU's Common Commercial Policy covers all the main measures affecting trade in goods and services and almost all trade-related issues, Trade-related areas partially covered by the common trade policy include: company law, indirect taxation, standards and other technical regulations, and enforcement of intellectual property rights. The Community policy on imports is determined in the following way: "imports into the Community are free from quantitative restrictions but only where more restrictive rules are not applicable". Restrictive rules apply for textiles and agricultural products. (Aarkog, 2005) B. In December 2005, the EU Commission announced that it would be phasing-out all export subsidies currentyl granted to exporters in the European Union. Critically discuss the likely implications for EU exports of the phasing-out of export subsidies. 60% World Trade Organization (WTO) members, which includes the European Union, are engaged in trade negotiations referred to as the Doha Development Agenda (DDA). The main aim of the negotiations is to minimize barriers to internal trade in agriculture, manufactured... On the basis of Article 133 of the European Community (EC) Treaty, the European Commission negotiates on behalf of the Member States in consultation with a special committee- the so-called "133 Committee". The 133 Committee is composed of representatives from the 25 Member States and the European Commission. Its main function is to coordinate the trade policy of the EU. The 133 Committee discusses the full range of trade policy issues affecting the EU, from the strategic issues surrounding the launch of rounds of trade negotiations at the WTO to specific difficulties with the export of individual products, such as textiles, and considers the trade aspects of wider EU policies in order to ensure consistency of policy. In this Committee, the European Commission secures endorsement of the Member States on all trade policy issues. The major formal decisions (for example agreement to launch or conclude negotiations) are then confirmed by the Council of the European Union. World Trade Organization (WTO) members, which includes the European Union, are engaged in trade negotiations referred to as the Doha Development Agenda (DDA). The main aim of the negotiations is to minimize barriers to internal trade in agriculture, manufactured products and services. One of the significant calls by the 2001 Doha declaration was the â€Å"reduction, in view to phase out, all forms of export subsidies†. This call was renewed again in 2004 during the negotiation for the â€Å"Framework for Establishing Modalities in Agriculture†.

The Legal Framework for Criminal Investigations and the Relationship Essay

The Legal Framework for Criminal Investigations and the Relationship with the Criminal Justice System - Essay Example This speaks itself about the importance of tough criminal investigation procedures. In order to collect reliable and secure evidence, the investigators must put in concrete efforts so that the person found guilty should be punished in accordance with law. Therefore, for a criminal prosecution to become successful, it is extremely important that the Crown Prosecution Services should provide solid and reliable evidence to the court of law to punish the culprits. â€Å"In a number of countries where democratic set up exists and where rule of law succeed, the burden of proof lies on the shoulder of the prosecution† (Conner et al 2008). The safeguards within the legal framework designed to protect people under criminal investigation Under the UK Law, those who are convicted by the lesser courts may file an appeal to higher court for the answer they are looking for. â€Å"The hierarchy of the courts starts from the magistrates / youth courts to the Crown Court, from the Crown Court to the Court of Appeal. However, in some exceptional cases further appeal is allowed to the Supreme Court only† (Cate 2008). Appeals to Courts that are higher up in jurisdiction are restricted to the point of law. If the right of appeal is obsessive for a convicted defendant, then he or she has the option to pursue to the administrative body known as Criminal Cases Review Commission (CCRC). If there is malpractice found then this renders the conviction irrelevant and sums up to the miscarriage of justice. â€Å"There are two sorts of ‘wrongful convictions a) One where the defendant is convicted unfairly b) other where a lack of fair trial makes it difficult to determine whether the defendant is guilty or not† (Sanders and Young 2010). Conviction through unfair means is considered a miscarriage of justice that raises many suspicions. The CPS sometimes allows appeals against acquittal especially if there is an error found in the law. For example, a jury member can be rejected if they attempt to prosecute with certain kinds of evidence that the judge feels that the police lacked the required legal power to secure that evidence. In a few cases, when compelling evidences of guilt comes to surface, fresh cases against the earlier acquittals can be restarted. â€Å"An element of criminal justice, which is not taken into account, is criminal defense; as per the law of the land, anyone arrested and taken into custody by the police officials is entitled to receive free legal aid from an adviser, usually a qualified legal practitioner† (Sanders and Young 2010). Great Britain is known to set aside funds for free legal representation to its people in the ordinary courts and the Crown Court. The wealthy classes of people usually do not take the benefit of legal representation and normally pay their legal fees from their own resources. â€Å"The numbers of litigants have two options a) present themselves or b) engage a solicitor to plead the cases of the poor. This is done by the government which hires the services of solicitors for them at the government’s expenses† (Sanders and Young 2010). The operation of safeguards within the legal framework   Section 47 enquiries aim at to minimize the destruction on the personality of a child and to ensure that the families are treated in a respectable way by the agencies. The Children Social Care organizations should appraise the guardians responsible for the security of

The chosen organization that shall be analyzed is Thringstone Supermarket Essay Example for Free

The chosen organization that shall be analyzed is Thringstone Supermarket Essay The chosen organization that shall be analyzed is Thringstone Supermarket, a well run, off license/newsagent located in a village called Thringstone, based in Small Heath. The organisation is owned by a married couple named Mr and Mrs Varu who are the sole proprietors. They sell a variety of products and ensure that customer needs and wants are met. Thringstone Supermarket has many regular customers, as this is one of the main Supermarkets as you enter in to the village. The supermarket is one of the local stores that are recognized by its entire local people as it offers a great variety of products. Within the Supermarket many products are sold including: Groceries Confectionary Newspapers, Magazines   Cards Stationary Alcohol Foods such as dairy products   Frozen foods Automated Teller Machine (ATM) 2.0 DESCRIPTION OF THE SERVICE CONCEPT The service concept is the way in which the customer perceives the organizations services (Johnston and Clark 2001). There are four key elements that form the service concept: à ¯Ã‚ ¿Ã‚ ½ The Service Experience Customers encounter different experiences which may vary from time to time when using a particular service. Mr. and Mrs. Varu can contribute to the service concept by delivering a friendly customer service experience, to make customers feel welcomed, this is what they expect. The customers want to do their shopping in a stress free, friendly environment and this is what Mr and Mrs Varu aim to achieve. Customers also like the noise level to be kept to a minimum when shopping so that they are not easily distracted and so that they can talk amongst themselves. à ¯Ã‚ ¿Ã‚ ½ The Service Operation Mr. and Mrs. Varu and the staff have a personalized basis with there customers, they recognize the majority of there customers and are on a first name basis. There is a trusting relationship between the customers and Mr. and Mrs. Varu and staff, therefore can guarantee that they can ask for assistance when needed without any negative attitude, therefore Mr. and Mrs. Varu provide assistance when required in a friendly manner to help deliver the service successfully. à ¯Ã‚ ¿Ã‚ ½ The Service Outcome This is the result the customer has received from the service provided. Mr. and Mrs. Varu aim to provide customers requirements by delivering there service and products successfully without any problems i.e. queues, no stock available, therefore customers can tell their friends and family by word of mouth that they received high quality service at Thringstones. à ¯Ã‚ ¿Ã‚ ½ The Service Value Shoppers value the experience and outcome in any organization, therefore the value must be cost effective otherwise customers will go elsewhere. Mr. and Mrs. Varu need to ensure that there customers are receiving a value for money service. Mr. and Mrs. Varu ensure that no out of date stock is displayed because customers only want to purchase goods that are to date and having out-of-date stock will give Thringstones a bad reputation which will send customers elsewhere because they are not receiving value for money products. Also, as they are situated in a village, and its miles to the nearest town centre, there ATM must be working at all times so customers can access their money easily instead of having to make journeys into town. The design elements for Thringstone Supermarket is available in appendix 1 3.0 The Servicescape An organizations servicescape describes the physical and informational surroundings of the delivery of the service provided. To secure strategy advantages from the servicescape, the needs of ultimate users and the requirements of various functional units must be incorporated into environmental design decisions. (Bitner 1992). * The physical appearance can determine where all products are kept. This can be identified as the process layout, where all similar products are put together, i.e. freezer foods are kept in one place. * The physical appearance of Thringstones also creates an impression to the customers. The letterhead is in white lettering with a red background. This makes Thringstones stand out and therefore inviting due to the bright and bold letters. * Customers require baskets to out there shopping in to, which allows the customers to shop comfortably and without difficulty. * Thringstones is located in a small village, which is easily accessible to customers; therefore the physical location of Thringstones is ideally suitable for customers. * The layout of the shop can help customers, access products easily. The aisles are kept clear and clean at all times in order for customers to gain access to products. * Health and Safety for customers is very important, i.e. if there is a wet floor, a wet floor sign is there for customers. Mr. and Mrs. Varu ensure that security cameras are placed around and outside the shop. * Mr. and Mrs. Varu use an automated stock control system which informs them when stock is low. This can keep control on the availability of products in stock. 3.1 Influencing customer behavior Mr. and Mrs. Varu believe customers behavior can be determined by the servicescape. * The freshness, clarity, and lightness influences customers behavior in the way they shop at Thringstones . If Thringstones has boxes of goods and baskets around the store this will influence the customer to shop in another place. * Products are neatly presented at Thringstones so that they are attractive to look at. Special displays are set out for the best presentation. A messy environment will make customers think twice about where to shop. * Availability of goods is always there i.e. if customers require a certain product that is not in stock, Mr. and Mrs. Varu can make sure that he orders it in so that it is made available for the customer the next time round. * Long queues will make customers uncomfortable, especially if they are in a hurry. Mr. and Mrs. Varu could loose money due to this. 4.0 Process Mapping The service process map combines the insights of flowcharting the service delivery process with the power of multivariate data analysis techniques (Collier 1991). The design of the service is important because the customer is directly and immediately involved in the delivery transaction. The customer is present and involved and they may even serve themselves. Appendix 2 provides a service process map for Thringstones. 4.1 Analysis of Process Map A method for analyzing the process map is by answering a set of questions to derive maximum advantage from it, these questions are obtained from Johnston Clark (2001). * Does the process support the strategic intention? Mr. and Mrs. Varus main objective is to provide a high quality service for there customers. Therefore, Mr. and Mrs. Varu must ensure all customers are able to purchase the relevant stock by firstly checking there stock availability and secondly by ensuring there shelves are fully stocked otherwise delays will be caused by staff having to get the stock from the back office. * Does each activity provide added value? At Thringstones added value activities are existent such as providing baskets, carrier bags and freezer bags. If these were not available customers would have to use there hands to carry their shopping, therefore Mr. and Mrs. Varu would be losing a lot of money due to customers purchasing limited goods. * Who owns and has responsibility for the process? Mr. and Mrs. Varu as well as the customers are responsible for the service process. Without either of them the process would not exist. Appendix 4 identifies the roles and responsibilities for the staff and customers. * How can the process be improved? Mr. and Mrs. Varu must ensure that stock is available at hand for customers, in order to meet there requirements. To maintain that customers can continue to shop in a clean and relaxing environment To ensure staff are fully trained to provide high quality customer service, and are able to deal with all types of customers in the correct manner i.e. difficult customers. If customers are waiting in long queues then Mr. and Mrs. Varu must realize that a new till may be required so delays will not take place. To provide a service where another member of staff packs the customers goods, this will speed the process up in the queues. * How efficient is the process? The process is very efficient as it aims the meet the organizations objectives. However this can only be achieved by ensuring that there is a continuous customer flow without any delays. Delays cause inefficiencies, which lead to dissatisfied customers, therefore Mr. Mrs. Varu are not fulfilling there business objective, which could cause a loss in profits. 5.0 The Service Quality Gap Model The service quality is the gap between a customers expected service and perceived service. A service quality gap model for Thringstones is available in appendix 3, and appendix 3.1 provides an analysis of the Service Quality Gap Model. 6.0 Job Design Mr. Mrs. Varu empower there staff for them to obtain the initiative to make decisions without consulting them first. Empowerment makes employees feel recognized and motivated as empowerment increases employees morale. Therefore empowering there staff will increase there productivity, reputation and provide a better service encounter. Appendix 4 provides the five dimensions to empowerment for Thringstones 7.0 Suggested improvements/recommendations Overall Mr. and Mrs. Varus Supermarket is an operation, which is customer orientated, like any other business operation he wishes to make as much profit as possible and at the same time keep customers satisfied by meeting their requirements. However, like any other business there is still, room for improvement and with the help of such policies and strategies, productivity and profit can be achieved for his business. This can be implemented in three was: 1. Increasing the number of tills in the shop 2. By introducing a Computer Bar coding system 3. Staff can be trained to be multi-skilled By increasing the capacity of tills, by adding in a further till can help in reducing the queuing system. As capacity is linked to time, many customers are not prepared to wait and maybe forced to shop elsewhere, this will lead to a reduction in sale and profit. Therefore by adopting this approach Mr. and Mrs. Varu can result in happier customers, and increase in productivity and even profits maybe achieved. Another area for improvement could be that a barcode system could be implemented, because at present Mr. and Mrs. Varu are running on a manual tilling system whereby they type in the price by hand and this is also another indicator of time wasting, thus leads to frustration for customers. This bar coding system could be implemented by scanning products through a computer which informs them what stock is in and it can also speed up the process dealing with all the customers without them having to waste time in queues. By using the computer bar code system this can help implement the Just In -Time Process. Instead of Mr. and Mrs. Varu going to the cash and carry, he can check on the computer of the goods, which are running low, and have them delivered by the cash and carry, this will result in less money being held in stock and also lead to extra space saved by not having unwanted stock, which can instead be converted into extra shop floor space. Thirdly, staff are to be trained so that they are multi-skilled. This will enable them to carry out a variety of jobs rather than just the ordinary replenishing of stock. For example, if they are till trained then the delivery system will be faster and this will lead to customer satisfaction. Overall, Mr. and Mrs. Varu can have competitive advantage over other newsagents in the area, as they will be using the more traditional approach and therefore by saving storage space, they can convert the back office area into shop floor space, which means they can sell extra products and will mean that customers are happy with the delivery of the service. Bibliography Books: Johnston, R and Clark, C (2001), Service Operations Management, Financial Times Prentice Hall Galloway, L, Rowbotham, F and Azhashemi, M (2000), Operations Management in Context, Butterworth Heinemann Oxford Lecture Notes: Lecture Two Job Design in Services Lecture Five the Design of Service Operations Journals: Bitner, M.J., Servicescapes: The impact of physical surroundings on customers and employees, Journal of Marketion, vol.56, April 1992, pp. 57-71. Gurdarshan Mudhar P01070281

International Marketing Research Essay Example for Free

International Marketing Research Essay 1. Identification of Case Issues Base your issues on theoretical international ethics concepts. As the international marketing manager, what are the ethical issues to be considered in this case? Use journals to help give your response depth The report aims at launching the new fair trade chocolate brand Mars, and analysing the current ethical understanding of the Japanese marketing environment. The business viewed the ethical issue which child slavery has created an unethical comparative advantage, and the current market for chocolate lies in the ethical ruin (Nicolas and Gittens, 2010). The result of the influence of fair-trade foods among Japanese shows that the participants in Japan do the ethical purchasing in observable condition much more than the anonymous condition (Kimura et al., 2012; Swaidan, 2012). The ethical purchasing of observable condition is about that about making products in an environment where there is no child abuse or child labour, that is environmentally conscious and where there is a value placed on workers and their safety (Nicholls and Opal, 2005; Impact of adverse economic shocks on the Indian child labour market and the schooling of children of poor households, 2012). Furthermore, the report claimed that is not only the purchasers’ participation of ethical â€Å"fair deal†, but also the corporation participations impact on fair trade as well; especially under the effect of the global economic recession, businesses have great potential to benefit or threaten at the market (Lynch, 2012; McCall-Rosenbluth and Thies,2011; Reed, 2009). According to the report of Swaidan (2012), Japan has suffered painful economic recession and a series of corporate misconducts and scandals over the last decade. In the meantime, peoples interests in business ethics and corporate social responsibility have remarkably increased (Tsalikis and Seaton, 2011). There are many similarities exist between Japanese and American managers which including the respective views on corporate social responsibility and unethical business practices (Tae and Nakano, 2008). Thus the marketing strategy should to consider the nation’s business ethical understandings. Furthermore, according to a personal perspective, the correct ethical behaviour differs, which includes the relativist, utilitarian, and Universalist perspectives and based on socio-economic status (Fletcher and Crawford, 2011; Lynch, 2012). It states a market where corruption is an issue as Japan ranked eighteenth on the Corruption Perception Index of major emerging markets (Tae and Nakano, 2008; Tsalikis and Seaton, 2011). In Japan, the primarily views business ethics are through relativist and utilitarian perspectives (Fletcher and Crawford, 2011; McCall-Rosenbluth and Thies, 2011; Nicolas and Gittens, 2010). It will evoke the previous ethical perspectives when business markets a fair trade product to the Japanese. The ethical behaviour differs across nations, influenced by popular attachments to governments, popular customs, level of economic development, relative size of public sector, low income for public servants, obscure legal and political environments, high level of government control and state ownership (Kimura et al., 2012; McCall-Rosenbluth and Thies, 2011; Swaidan, 2012). Moreover, according to Hofstede’s four cultural dimensions, Japan outranks all other countries in the measure of masculinity (Fletcher and Crawford, 2011). Hence, the marketing strategy must cater to the nation’s business ethical behaviours, and cultural dimensions facing fair trade products. 2. Formulation of alternatives or possible solutions with respect As the International marketing manager what are some alternative solutions, based on an ethical platform? Use journals to support your alternatives. Mars’ first entered the Asian market with a marketing strategy of sponsoring and becoming the official snack food of the 1990 Asian Games in Beijing (McElhatton, 2012). In addition, it claims that Mars has a legacy for aggressive instincts in international expansion, entering the Eastern European markets after the collapse of the Soviet Union in 1991 (Allen, 2010). These movements lead to factories being opened in the Asian markets to better understand the domestic environments, and it is the solid foundation for Mars to target and market the Japanese market which it was successful in combining investment with community activities to relay positive company behaviour in the political environment (McElhatton, 2012). Additionally, it proved that a link exists in successful brands between company ethical and social requirements, and the company’s commitment to protecting consumer rights and interests (Castaldo, Perrini, Misani and Tencati, 2011; Fletcher and Crawford, 2011; McCall-Rosenbluth and Thies, 2011). Thus, Mars must show it is not only has corporate social responsibility but its interest in the rights of its consumers, in order to market a new fair trade brand of chocolate in Japan (Nicolas and Gittens, 2010). Further, the right for Mars’ consumers to have access to chocolate is fair trade that gives added value and competitive price (Allen, 2011). From the perspective of economies, fair trade marketing may be successful if it is existed that consumers whose additional willingness to pay for fair trade products are greater than the additional marginal costs (Lynch, 2012). However, the consumers who felt greatly affected by the global recession yet want to consume ethically, marketers must deliver value without compromising these social values (Castaldo, Perrini, Misani and Tencati, 2011). The report confirmed that the Japanese expect companies to stand behind their product well after a sale is made. They are not particularly price conscious, but rather rely on trust (McCall-Rosenbluth and Thies, 2011; McElhatton, 2012). Moreover, there are restraining forces in the market such as political systems, legal requirements, cultural norms and economic development, that hinder the free flow of fair trade in the market (Fletcher and Crawford, 2011). In Japan, it is not simply enough to support the goods, but marketing mix is more important to the Japanese consumers who demand the after-sale services on financial resources, and the weakness of service is not tolerated in the Japanese market (Slavery involved in food production, 2008; Swaidan, 2012; Tsalikis and Seaton, 2011). On the other hand, the benefits of lowering 20 percent tariff of chocolate imports in Japan which is almost three times of the USA levy on imported candy (McCall-Rosenbluth and Thies, 2011; Reed, 2007). The chocolate potential market for Mars grows as the high tariff is getting lowered, and allowing a new fair trade chocolate brand greater entry. If Japan is a significant leader in the Asian region drops its tariff, Korea as the other major potential market may follow (Allen, 2011; Tae and Nakano, 2008). Japanese have their own take on Valentines Day which is a big chocolate buying frenzy (Tsalikis and Seaton, 2011). Gifts of chocolate from women to men on St Valentines Day have become a subtle key to gender empowerment in Japan. In Japan, women nationwide buy chocolates for their male co-workers rather than husbands and loved ones (Lewis, 1995). With this custom, women have successfully monopolized the means of socially defining chocolate, which is a large promoter for the industry. Being a custom based on culture, chocolate sales in Japan on Valentine’s Day continue to increase as cocoa prices soar. It means that the duty is expanding, which could offer the new opportunities for an ethical fair trade choice in the region (Allen, 2011; Fletcher and Crawford, 2011). Thus, marketing to the Japanese based on custom rather than the individual consumer is advised. 3. Recommendation or choice of solution Make a stand. What would you do as the International marketing manager for this company, based on an ethical platform? What are you going to recommend to the board? First of all, Japan is a rapidly growing market where corruption is an issue. The stakeholders should be the focus, and holistic and corporate social responsibility marketing is a strategic consideration (Tae and Nakano, 2008; Tsalikis and Seaton, 2011). The chocolate company Mars is recommended to use value-based labelling in order to increase consumer awareness of the brand. Moreover, individuals’ motivations from extrinsic social factors such as reputation-enhancing opportunities should be moulded around brand appearance and marketing strategy, which is rely on the product add value to the consumer thereby further building and maintaining the loyalty of the consumers (Fletcher and Crawford, 2011; McCall-Rosenbluth and Thies, 2011; Nicolas and Gittens, 2010). Secondly, a market-oriented solution is best for entering and marketing a fair trade chocolate brand in Japan, because Japan is a viable market to launch a brand, currently ranked third in world GDP (McCall-Rosenbluth and Thies, 2011; Tyler, 2012). The chocolate company Mars should consider about the ownership attributes, the location attributes and the internalisation for market entry (McElhatton, 2012). Mars could use the host marketers for the purpose of launching the market strategy from within the domestic environment. Furthermore, Mars could report the ethical practises to consumers which include ethical initiatives such as discontinuing marketing to children under age 12, and it is rely on brand integrity through Mars’ philosophy of â€Å"mutuality of benefits† for all stakeholders (Reed, 2007). It might offset distribution regulations and prevent ethical, legal and cross-cultural misunderstanding in brand marketing and promotion (Fletcher and Crawford, 2011; McCall-Rosenbluth and Thies, 2011). Thirdly, Countries differ greatly in their ethical standards and consumer expectations (Tae and Nakano, 2008). In Japans political system, dominant economic interests caused deep changes, so in the other word, Japan is the very embodiment of stability (Tsalikis and Seaton, 2011). On the other hand, as approximately ten percent of sales are from the Australasian region, Mars success has resulted from a simply philosophy â€Å"go where the consumer economy is growing† and â€Å"the consumer is our boss.† (McElhatton, 2012; Tyler, 2012). Thus, the assessment predicts a minor political could impact of the new product brand and low transaction cost (Fletcher and Crawford, 2011). Last but not least, Japan has greater equality of incomes between higher and lower incomes and market incomes (Kimura et al., 2012). This is ever more present as Japanese consumer social awareness grows and the distance is shortened between company and customer, due to communication advancements (McCall-Rosenbluth and Thies, 2011). The chocolate company Mars could potentially take a large market segment by marketing a CSR strategy in this high-income country via differentiation (Allen, 2011). Besides, the growth of e-commerce has diminished national barriers, thus advertising campaigns directed at the Japanese market can be optimised online (Fletcher and Crawford, 2011; McElhatton, 2012). References Allen, L.L. (2011). Chocolate fortunes: the battle for the hearts, minds, and wallets of Chinese consumers. Retrieved from http://site.ebrary.com.ezp01.library.qut.edu.au/lib/qut/docDetail.action?doID=10342364 Castaldo, S., Perrini, F., Misani, N., Tencati, A. (2011). The missing link between corporate responsibility and consumer trust: the case of fair trade products. Journal of Business Ethics, 84, 1-15. doi: 10.1007/s10551-008-9669-4 Fletcher, R., Crawford, H. (2011). International marketing: an Asia-Pacific perspective 5th edition. Frenchs Forest, NSW: Pearson Australia. Kimura, A., Mukawa, N., Yamamoto, M., Masuda, T., Yuasa, M., Goto, S., Oka, T., Wada, Y. (2012). The influence of reputational concerns on purchase intention of fair-trade foods among Japanese adults. Food Quality and Preference, 26(2), 204-210.

Genetic Diversity and QoI Fungicide Resistance

Genetic Diversity and QoI Fungicide Resistance Study of genetic diversity and QoI fungicide resistance in frogeye leaf spot (Cercospora sojina) from Tennessee Introduction Frogeye leaf spot (FLS) of soybean (Glycine max Merr.), caused by the fungal pathogen C. sojina Hara, was first identified in Japan in 1915 and South Carolina, the United States in 1924 (Lehman 1928; Phillips 1999). FLS is an important foliar disease of soybean although symptoms can appear on stems, pods, and seeds. There has been no report of the alternative host in other crops or weeds (Mian et al. 2008). Initial symptom appears as small, light brown circular spot which is later surrounded by darkish brown to reddish circle. (Dashiell and Akem 1991). As the leaves are covered with 50% lesions, leaves start to blight wither and finally falls prematurely. On the lower surface of leaves, the central spot of lesions is somewhat grayish because of conidia produced on conidiophores. Conidia are a primary and secondary source of inoculum and are produced in infected leaves, stems, and pods. Warm temperature and frequent rainfall are suitable factors for severe disease, and fully expanded leaves are more resistant with small lesions as compared to younger leaves (Phillips 1999). The United States is the leading producer of soybean in the world. According to the food and agriculture organization (FAO), the US produced 108 million metric tons of soybeans, second only to corn in 2014 (http://faostat3.fao.org/). FLS is an important disease in most of the soybean growing countries in the world and the main factors hindering the yield includes a reduction in photosynthetic area and premature defoliation of leaves (Mian et al. 2008; Wrather et al. 2010). In the US, FLS is significantly present in Southern warm and humid regions (Mian et al. 2008; Yang et al. 2001). Now, C. sojina is also important to Northern states as the disease was reported in Iowa in 1999, Wisconsin in 2000 (Mengistu et al. 2002) and Ohio in 2006 (Cruz and Dorrance 2009). The damage caused by FLS depends on soybean cultivars and locations, and yield loss has been reported from 10% to more than 60% (Dashiell and Akem 1991; Hartwig and Edwards Jr 1990; Laviolette et al. 1970; Mian et al. 1998). FLS is a polycyclic disease and the disease remains active throughout the growing season (Kim et al. 2013; Laviolette et al. 1970). Dispersal of conidia to some distance is favored by the wind and water splashes (Laviolette et al. 1970). Mycelium of C. sojina can overwinter and a report suggests potential survival of the pathogen in the plant debris for two years (Zhang and Bradley 2014). There are several FLS control methods including cultural practices, use of fungicides and genetic resistance. Primarily, genetic resistance is a most effective measure to control FLS. Till now, three resistant genes Rcs (Resistant to C. sojina), have been deployed: Rcs1 (Athow and Probst 1952), Rcs2 (Athow et al. 1962) and Rcs3 (Phillips and Boerma 1982). The Rcs3 gene confers resistant against race 5 and all known races of C. sojina present in the USA. (Mengistu et al. 2012; Phillips and Boerma 1982). Similarly, crop rotation for two years has been suggested to skip viable inoculum and prevent dise ase severity in the field (Grau et al. 2004; Zhang and Bradley 2014). Further, use of pathogen-free seeds and necessary application of fungicides before flowering to early pod stage have been practiced to decrease disease severity (Grau et al. 2004). Meanwhile, because of change in the pathogen, it has been proven that resistant gene can confer resistance for a certain period and there can be selection against QoI fungicides too (Athow and Probst 1952; Athow et al. 1962; Zeng et al. 2015). There has already been a report of field isolates resistant to QoI fungicides in Tennessee (Zhang et al. 2012). Control measures like use of fungicides and planting of resistant cultivars force pathogens to select against selection pressure. Studies of C. sojina using several approaches indicate diversity among isolates. Because of the lack of universally accepted soybean differentials, its hard to characterize and compare C. sojina isolates. Grau et. al. (2004) have reported 12 races of C. sojina in the US, 22 races in Brazil and 14 races in China. A new set of 12 soybean differentials and 11 races have been proposed based on the reaction of isolates collected from the USA, Brazil, and China (Mian et al. 2008). However, the reaction of 50 isolates from Ohio on the same 12 soybean differentials produced 20 different races (Cruz and Dorrance 2009). There has been a handful of research to characterize C. sojina based on molecular markers. One study includes AFLP based assessment of 62 isolates from Brazil, China, Nigeria and the United States, which showed a significant amount of genetic diversity among isolates, although genotypes did not cluster based on origin. (Bradley et al. 2012). Recently, a study of 132 isolates fr om Arkansas with simple sequence repeat (SSR) has shown the chances of sexual reproduction and high genetic diversity in C. sojina (Kim et al. 2013). The main objectives of this study were to access: genetic diversity by developing and using novel SNP markers and distribution of QoI resistant and sensitive isolates from Jackson and Milan, TN. Sample collection, Single-lesion Isolation, and DNA extraction In 2015, soybean leaves exhibiting typical symptoms of infection with FLS were collected from research plots at two locations in Tennessee (Milan and Jackson). In total, 437 isolates, 203 from Jackson and 234 from Milan, were collected from eight fungicides treated and non-treated Maturity group III soybean cultivars (Table 1). Cultivars were planted in 4 rows (30-inch row spacing), 30 ft long plots in a randomized complete block design with four replications. Plots were split, two rows were not treated, and two rows were treated at R3 growth stage (beginning pod) with Quadris Top SB at 8 fl oz/a (Azoxystrobin and Difenoconazole, Syngenta Corp., Basel, Switzerland). A single isolate of C. sojina was obtained from a single lesion from each leaf. Sporulation was induced by incubating leaves in a plastic bag with moist towels at room temperature. Spores were harvested with a flame-sterilized needle using a dissecting microscope and 8-10 spores transferred to RA-V8 agar media (rifampicin 25 ppm, ampicillin 100 ppm, 160 mL unfiltered V8 juice, 3 gm calcium carbonate and 840 mL water). Observations were made daily and contaminated sectors removed. After seven days, single-lesion isolates of C. sojina were transferred to a new V8 agar media. In addition, a set of 40 isolates from 10 different states, collected before 2015, were included in this study (Table 2). Table 1. Soybean cultivars and number of Cercospora sojina isolates recovered from treated and non-treated cultivars. Cultivar ID Cultivars Jackson Milan Total Treated Non-treated Treated Non-treated C1 VAR Armor 37-R33 RR2 17 11 21 4 53 C2 VAR Asgrow AG3832 GENRR2Y 7 15 20 14 56 C3 VAR Becks 393R4 0 0 0 3 3 C4 VAR Croplan R2C 3984 19 13 11 14 57 C5 VAR Mycogen 5N393R2 RR2 g 12 20 17 28 77 C6 VAR Terral REV 39A35 10 15 13 16 54 C7 VAR USG 73P93R 22 6 13 21 62 C8 VAR Warren Seed 3780 R2Y It 14 22 13 26 75 Table 2. Number of Cercospora sojina isolates collected from Jackson (JTN) and Milan (MTN), Tennessee in 2015 and historical isolates from various states in previous years. Location No. of Samples Year JTN 203 2015 MTN 234 2015 AL 5 2006 AR 5 2006 FL 1 2006 GA 4 2006 IA 1 2006 IL 2 2006/09 LA 1 2006 MS 6 2006 SC 2 2006/2009 TN 12 2007 WI 1 2006 Note: JTN (Jackson) and MTN (Milan) collection in 2015 in Tennessee. TN is a historical collection. For DNA extraction, the single-lesion isolates were grown in 24-well deep well plates (Fisher Scientific) with 1 mL RA-V8 liquid broth (same as above, minus the agar) per well. DNA was extracted as described by Lamour and Finley (2006). Briefly, this includes harvesting mycelium from the broth cultures into a 96-well 2 mL deep well plate pre-loaded with 3-5 sterilized 3 mm glass beads. The plates are freeze dried and the dried mycelium powdered using a Mixer-Mill bead beating device (Qiagen). The powdered mycelium was then lysed and a standard glass fiber spin-column DNA extraction completed. The resulting genomic DNA was visualized on a 1% gel and quantified using a Qubit device. SNP marker discovery and targeted-sequencing based genotyping Whole genome sequencing was accomplished for three FLS isolates from a historical collection originally compiled by Dr. Dan Philips, UGA: FLS11 (CS10117) recovered from Milan, Tennessee in 2010, FLS19 (TN10) from the Georgia Experiment Station, and FLS21 (TN85) which was recovered from Mississippi. Genomic DNA was extracted from freeze-dried and powdered mycelium using a standard phenol-chloroform approach and the resulting DNA was submitted to the Beijing Genomics Institute in China for 2100 paired-end sequencing on an Illumina HiSeq2000 device. De novo assembly, read mapping and SNP discovery was accomplished with CLC Genomics Workbench 7 (Qiagen). As there was no public reference genome available at the time, FLS21 was de novo assembled using the default settings in CLC and the resulting contigs used as a reference genome. All open reading frames (ORFs) longer than 300 amino acids were predicted using CLC and annotated onto the FLS21 contigs. The raw reads from FLS11 and FLS19 wer e then mapped to the draft reference (separately), and putative single nucleotide variants (SNVs) identified at sites with at least 20X coverage and an alternate allele frequency greater than 90%. A subset of the SNVs was chosen from the largest contigs for further genotyping using a targeted sequencing approach. Custom Perl scripts were used to extract the flanking sequences for the panel of SNPs and primers were designed using BatchPrimer3 v1.0 (http://probes.pw.usda.gov/batchprimer3/) to amplify targets between 80 and 120bp in length. Primers for 50 SNPs including mitochondrial QoI resistant locus are summarized in Table 3. Primer sequences and genomic DNA were sent to Floodlight Genomics (Knoxville, TN) for processing as part of a non-profit Educational and Research Outreach Program (EROP) that provides targeted-sequencing services at cost for academic researchers. Floodlight Genomics uses an optimized Hi-Plex approach to amplify targets in multiplex PCR reactions and then sequences the resulting sample-specific amplicons on either an Illumina or Ion NGS device. Resulting sample-specific sequences were mapped to the reference contigs and genotypes assigned for loci with at least 6X coverage. QoI resistant locus genotyping A single nucleotide polymorphism (G/C) in the Cytochrome b gene of the C. sojina mitochondrial genome has been shown to confer resistance to QoI fungicides. A custom TaqMan SNP genotyping assay will be designed using the online design tools from Applied Biosystems (Thermo Scientific) and include the forward primer GGGTTATGTTTTACCTTACGGACAAATG and reverse primer GTCCTACTCATGGTATTGCACTCA and two probes to discriminate resistant and sensitive isolates: ACTGTGGCAGCTCATAA with VIC for the C resistance allele and ACTGTGGCACCTCATAA with FAM for the G sensitive allele (Zeng et al. 2015). Quantitative PCR (qPCR) will be accomplished based on manufacturer instruction using the QuantStudio 6 Flex Real-time PCR System (Thermo Fisher Scientific Inc.). Mating types determination A previously described multiplex PCR assay will be used to assign mating type (MAT1-1-1 or MAT1-2) to a subset of the isolates that had unique multi-locus SNP genotypes (Kim et al. 2013). The MAT1-1-1 locus will be amplified with CsMat1f (5 TGAGGACATGGCCACCCAAATA) and CsMat1r (5 AAGAGCCCTGTCAAGTGTCAGT) and the Mat1-2 locus will be amplified with CsMat2f (5 TGTTGTAGAGCTCGTTGTTCGCA) and CsMat2r (5 TCAGACCTTATGAGCTTGAAAGTGCT) primers (Kim et al. 2013). The assay will be included with the ITS5 (5 GGAAGTAAAAGTCGTAACAAGG) and ITS4 (5 TCCTCCGCTTATTGATATGC ) primers as an internal control to amplify the internal transcribed spacer (ITS) region (White et al. 1990). The resulting PCR products will be visualized under UV light on 2% agarose gel stained with GelRed (Phenix Research Products) and scored based on fragment size of MAT1-1-1 (405 bp) and Mat1-2 (358 bp). Data Analysis SNP loci for each sample will be combined to form a multi-locus SNP genotypes and samples with identical genotype (clonal lineages) will be clone corrected. To assess population structure among the two locations (and in relation to the historical isolates), Bayesian clustering will be accomplished using Structure 2.3.4 (Pritchard et al. 2000). Structure Harvester (Earl 2012) will be used to find the most probable value of K from the results obtained from Structure analysis. Principle coordinate analysis, AMOVA, Nei pairwise genetic distance, Nei pairwise genetic identity and genetic indices will be analyzed with GENALEX (Peakall and Smouse 2006). Phylogenetic clustering of the unique genotypes will be accomplished using Mega 6.06 (Tamura et al. 2013). Minimum spanning networks (Bandelt et al. 1999) will be constructed with PopART (http://popart.otago.ac.nz/). Expected Results Novel SNP markers will be developed and assayed in C. sojina isolates. Population study will help to determine if the isolates from two locations are sub-grouped. The genetic study will also accesses genetic diversity present within and among populations. Molecular identification of mutated cytochrome b site will help to determine the distribution of resistant isolates and contribute to compare resistant isolates in fields between two different time periods. Study of two different mating types in population will help to predict sexual reproduction. References Athow K and Probst AH. 1952. The inheritance of resistance to frog-eye leaf spot of Soybeans. Phytopathology 42(12):660-662 pp. Athow KL, Probst AH, Kurtzman CP and Laviolette FA. 1962. A newly identified physiological race of Cercospora sojina on soybean. Phytopathology 52(7):712-714 pp. Bandelt H-J, Forster P and RÃ ¶hl A. 1999. Median-joining networks for inferring intraspecific phylogenies. Molecular biology and evolution 16(1):37-48. Bradley C, Wood A, Zhang G, Murray J, Phillips D and Ming R. 2012. Genetic diversity of Cercospora sojina revealed by amplified fragment length polymorphism markers. Canadian Journal of Plant Pathology 34(3):410-416. Cruz C and Dorrance A. 2009. Characterization and survival of Cercospora sojina in Ohio. Plant Health Progress doi 10. Dashiell K and Akem C. 1991. Yield losses in soybeans from frogeye leaf spot caused by Cercospora sojina. Crop Protection 10(6):465-468. Earl DA. 2012. STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation genetics resources 4(2):359-361. Grau CR, Dorrance AE, Bond J and Russin JS. 2004. Fungal diseases. Soybeans: Improvement, production, and uses(soybeansimprove):679-763. Hartwig E and Edwards Jr C. 1990. The uniform soybean tests, southern region, 1989. USDA Mimeographed Rep. US Gov. Print. Office, Washington, DC. Kim H, Newell AD, Cota-Sieckmeyer RG, Rupe JC, Fakhoury AM and Bluhm BH. 2013. Mating-type distribution and genetic diversity of Cercospora sojina populations on soybean from Arkansas: Evidence for potential sexual reproduction. Phytopathology 103(10):1045-1051. Laviolette F, Athow K, Probst A, Wilcox J and Abney T. 1970. Effect of bacterial pustule and frogeye leafspot on yield of Clark soybean. Crop science 10(4):418-419. Lehman S. 1928. Frog-eye leaf spot of Soy Bean caused by Cerco-spora diazu Miara. Journal of Agricultural Research 36(9):811-833. Mengistu A, Bond J, Mian R, Nelson R, Shannon G and Wrather A. 2012. Resistance to Frogeye Leaf Spot in selected soybean accessions in MG I through MG VI. Plant Health Progress 10. Mengistu A, Kurtzweil NC and Grau CR. 2002. First report of Frogeye Leaf Spot (Cercospora sojina) in Wisconsin. Plant Disease 86(11):1272-1272. Mian M, Boerma H, Phillips D, Kenty M, Shannon G, Shipe E, Blount AS and Weaver D. 1998. Performance of frogeye leaf spot-resistant and-susceptible near-isolines of soybean. Plant disease 82(9):1017-1021. Mian M, Missaoui A, Walker D, Phillips D and Boerma H. 2008. Frogeye Leaf Spot of Soybean: A review and proposed race designations for isolates of Hara. Crop science 48(1):14-24. Peakall R and Smouse PE. 2006. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular ecology notes 6(1):288-295. Phillips D. 1999. Frogeye leaf spot. Compendium of soybean diseases, 4th ed. American Phytopathological Society Press, St. Paul, MN:20-21. Phillips D and Boerma H. 1982. Two genes for resistance to race 5 of Cercospora sojina in soybeans. Phytopathology 72(7):764-766. Pritchard JK, Stephens M and Donnelly P. 2000. Inference of population structure using multilocus genotype data. Genetics 155(2):945-959. Tamura K, Stecher G, Peterson D, Filipski A and Kumar S. 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular biology and evolution:mst197. White TJ, Bruns T, Lee S and Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications 18(1):315-322. Wrather A, Shannon G, Balardin R, Carregal L, Escobar R, Gupta G, Ma Z, Morel W, Ploper D and Tenuta A. 2010. Effect of diseases on soybean yield in the top eight producing countries in 2006. Plant Health Progress doi 10:2008-2013. Yang X, Uphoff M and Sanogo S. 2001. Outbreaks of soybean frogeye leaf spot in Iowa. Plant Disease 85(4):443-443. Zeng F, Arnao E, Zhang G, Olaya G, Wullschleger J, Sierotzki H, Ming R, Bluhm B, Bond J and Fakhoury A. 2015. Characterization of quinone outside inhibitor fungicide resistance in Cercospora sojina and development of diagnostic tools for its identification. Plant Disease 99(4):544-550. Zhang G and Bradley CA. 2014. Survival of Cercospora sojina on soybean leaf debris in Illinois. Plant Health Prog 10. Zhang G, Newman M and Bradley C. 2012. First report of the soybean frogeye leaf spot fungus (Cercospora sojina) resistant to quinone outside inhibitor fungicides in North America. Plant Disease 96(5):767-767.

America and the Great Depression Essay examples -- Essays Papers

America and the Great Depression 1. Compare the ideas behind the protest movements of Huey Long and Upton Sinclair. The Era of the Great Depression was one of both desperation and hope. Americans were desperate for a change, desperate for anything to come along that may improve their situation, yet hopeful that the light at the end of the tunnel was near. For many of those living in poverty during the 1930s, the â€Å"radical† leftist movements seen throughout the country appeared to be alternatives to the sometimes ineffective programs of FDR’s New Deal. Two such programs, Huey Long’s â€Å"Share Our Wealth† plan and Upton Sinclair’s End Poverty in California (EPIC) were fairly popular, mainly for their appealing alternatives to the current New Deal programs and ideals. Though the two movements were similar in some sense, both had different visions for the recovery of the American people. Huey Long, two-time Senator of Louisiana, was founder of the â€Å"Share Our Wealth† plan. A redistribution of the nation’s wealth, the plan called for one third of the country’s money to be divided among all the people. In the early 1930s, 4% of the American population held 87% of the wealth. (Polenberg 127) Long’s plan called for an end to this imbalance. â€Å"None too poor, none too rich† was his slogan. (Polenberg 126) The â€Å"Share Our Wealth† movement was made up of eight parts. A homestead allowance granted by the government to all families (and a limit on how large a family’s fortune could be), minimum family yearly incomes (and limits on excessive ones), better regulation of work hours (to prevent overproduction), an old-age pension, a balance between agricultural production and consumption, a pension for veterans and their disabled, ... ...me president. Their programs however, did have lasting effects on the government at the time, causing it to shift towards the left in order to appease their supporters. The fact that two men with very different visions for the future of Americans could both be so popular while endorsing such radical changes only shows the true atmosphere of America in the Depression. Americans in poverty were willing to cling to any hope they could find, and though each did it in their own way, these men gave Americans that hope. Bibliography 1. Biles, Roger. A New Deal for the American People. Northern Illinois University Press. DeKalb, 1991. 2. Polenberg, Richard. The Era of Franklin D. Roosevelt 1933-1945. Bedford/St. Martin’s. Boston, 2000. 3. Terkel, Studs. Boston, 2000. 4. Terkel, Studs. Hard Times. The New Press. New York, 1970

Is Abortion Ever Justfied? Essays -- essays research papers

Is abortion ever justified? If not, why? If it depends, then on what? It is not unreasonable to suggest that the vast majority of people consider it morally wrong to kill other persons. There may be examples of situations where the killing of a person may be justifiable, although they are by no means universally consented to, such as killing in self defence or as a form of capital punishment, but taken in isolation it is generally accepted that to kill is wrong. Therefore in the debate between pro and anti abortionists must centre around two essential questions: whether a foetus is a person, and if so when a foetus becomes a person; and whether abortion can be said to be self defence. Possibly the deepest dilemma for an anti abortionist concerns the stage at which a foetus can be said to be alive, in the sense in which we would refer to a child after it is born. It seems absurd to think that in the relatively short time which the birth takes, the baby’s status will be so radically altered yet an almost mystical store is set by birth as for the first time we can distinguish a distinct personality, and directly interact with the infant . However, it is a largely unfounded significance in ethical terms as birth is often governed by contingent factors and the time of birth can be manipulated. Also to be considered is the fact that if the baby is ready to emerge from the womb, then surely it possesses enough properties for us to consider it in some sense a person. For example, if not than an eight month old foetus would not have the same claim to personhood as a two-month-old baby born prematurely at six months even though they are of similar developmental stage s. Thus other stages of pregnancy are more commonly cited as the point in which personhood begins. John Grigg adopts the stance that there is a life that comes into existence as soon as conception occurs: â€Å"To my mind life begins at the moment of conception†¦ Conception is the magic moment.† (John Grigg, in the Guardian, 29 October 1973) This view may be problematic if we consider that life does not necessarily imply personhood. We may claim that the foetus is a human being but this merely implies that it is a member of our species, and not that of another. Yet it is at least true to say that a foetus, even in the earliest stages of pregnancy has the potential to be a person. This is slightly differe... ...elf defence, even though the foetus has no intention to harm the woman, it is a sad situation in which both parties might be thought of as morally blameless. However, can any abortion said to be self-defence? The reaction to an intrusion in the home may be said to be defence, yet a house is worth far less than your own body. The title question of this essay and the questions raised within it remain unconcluded. The problem is not that there are no answers, rather there are too many. The issue is complicated further by the fact that every single situation is different. Abortion is a very personal issue that effects many people in the world, the average Russian woman has twelve abortions in her life, it is also an especially emotional subject. Abortion is justified everyday, however whether it is a practice that can be morally justified with any universal consent is another issue. The only way I can see that abortion might receive the most moral acceptance, is that if it is presented on the grounds that we must all step back and respect that other moral agents have a right to make autonomous decisions, regardless of what we think about the way they choose to assert their autonomy.

The Democratic Value of Whitmans Leaves of Grass Essay -- Whitman Lea

Early reviews of Walt Whitman's Leaves of Grass evince an incipient awareness of the unifying and acutely democratic aspects of the poetry. An article in the November 13th, 1856, issue of the New York Daily Times describes the modest, self-published book of twelve seemingly formless poems: "As we read it again and again, and we will confess that we have returned to it often, a singular order seems to arise out of its chaotic verses" (2). The Daily Times's identification of "order" out of "chaos" in Leaves of Grass parallels America's theoretical declaration of e pluribus unum, one out of many—a uniquely democratic objective. Also manifesting the early perception of the democratic poetic in Leaves of Grass, yet focusing more on Whitman and his content, an 1856 edition of the North American Review asserts, "Walter Whitman, an American,—one of the roughs,—no sentimentalist,—no stander above men and women, or apart from them,—no more modest than immodes t,—has tried to write down here, in a sort of prose poetry, a good deal of what he has seen, felt, and guessed at in a pilgrimage of some thirty-five years" (275). Here, Whitman is seen as the archetypal American, practicing the democratic ideal of human equality. The reviewers' awareness of order out of chaos and of the ideological American attitude of equality is a written history of the problems of nineteenth-century, post-Jacksonian America, for the presence of their observations, which celebrate Whitman's democratic vision, can only suggest the absence of that vision in American politics and culture. Indeed, the language of mid-nineteenth-century reviews of Leaves of Grass reflects nostalgia for the community focus of early Jeffersonian America, a focus that was fading in a cul... ...ca's Lyric-Epic of Self and Democracy. New York: Twayne, 1992. - - - . Walt Whitman. Boston: Twayne, 1990. Remini, Robert V. The Legacy of Andrew Jackson: Essays on Democracy, Indian Removal, and Slavery. Baton Rouge: Louisiana State UP, 1988. Southard, Sherry. "Whitman and Language: Great Beginnings for Great American Poetry." Mount Olive Review 4 (Spring 1990): 45-54. Warren, James Perrin. Walt Whitman's Language Experiment. University Park: Pennsylvania State UP, 1990. Whitman, Walt. "After the Sea-Ship." Bradley and Blodgett 263. - - - . "As I Ebb'd with the Ocean of Life." Bradley and Blodgett 253-256. - - - . "On the Beach at Night Alone." Bradley and Blodgett 260-261. - - - . "Song for All Seas, All Ships." Bradley and Blodgett 261-262. - - - . "Preface 1855—Leaves of Grass, First Edition." Bradley and Blodgett 711-731.

Survey In Forensic Toxicology Health And Social Care Essay

The province of alcoholism and the blood intoxicant concentration of a individual at the clip of decease can sometimes be hard to construe due to the assorted post-mortem artefacts that can change the true ante-mortem blood intoxicant concentration. The opportunity of intoxicant being produced in the organic structure after decease is a continuously encountered issue in everyday casework [ 2 ] . The status and province of the organic structure, the clip between decease and sample aggregation, the environmental conditions and besides the type of samples collected, preserved and analyzed are all of import factors that should be considered carefully during reading. Under certain status ethyl alcohol can be produced after decease by agitation of glucose and due to bacterial activity [ 3,4 ] . Some illustrations in which the blood ethanol concentration at the clip of decease can be altered are: The possibility of ethanol production in the organic structure after decease or after sample aggregation due to microbic production ; If ethanol remains in the tummy after decease, the possibility is of continued local diffusion into the environing tissue and blood is raised ; In instances of caput injury which has rendered a individual unconscious for a few hours prior to decease, the blood ethanol concentration during this clip continues to diminish due to metamorphosis in the liver. Some other instances that may be debatable to cover with are instances where the organic structures are recovered from H2O in which the possibility of sample dilution can play a important function [ 2 ] . These are merely a few illustrations of the many possibilities that can change ethanol concentration and do reading of post-mortem ethanol concentration really hard. It is hence of great importance in forensic post-mortem ethanol instances to execute accurate and precise analysis for ethyl alcohol, to utilize the optimum specimen and to cognize the restrictions and significance of ethanol findings in these specimens [ 5 ] . The optimum specimen picks, aggregation site, and preservatives, every bit good as the deductions and reading of ethanol findings in post-mortem ethyl alcohol instances will be discussed in this paper.2. Postmortem Specimen for analysis of Ethanol.In malice of the troubles encountered with post-mortem ethanol consequences, an necropsy offers the chance to roll up specimens that are non readily available in ante-mortem cases.A A In add-on to trying blood from different vascular sites and piss, samples collected from vitreous wit and stomachic contents every bit good as musculus, encephalon and liver tissues, cerebrospinal fluids and gall are all possible during necropsy. Although there is a possibility to roll up and analyse ex tra specimens during post-mortem ethanol analyses, this will merely partially counterbalance for the increased interpretative troubles encountered by the assorted post-mortem artifacts.A A It is hence necessary to use a greater grade of cautiousness during the reading of post-mortem ethanol consequences and to take into history the entirety of the information obtained. A individual post-mortem blood ethyl alcohol concentration is by and large uninterpretable without a coincident piss and/or vitreous wit ethanol concentration ; therefore it is of import that every bit good as information sing the instance history and inside informations gathered from the scene of decease [ 1 ] .A A Due to this it is of import alternate specimen should ever be collected and analyses in order to right and safely confirm ante- mortem ethanol ingestion. In this chapter the different types of specimen used for post-mortem ethanol analyses every bit good as there deductions and restrictions will be discussed.2.1 Blood Alcohol ConcentrationAlthough there are multiple samples available for aggregation at necropsy for toxicological analysis of ethyl alcohol, blood is a important in leting valid decision of whether the deceased has consumed intoxicant and was under influence at the clip of decease. The basic information required, on construing the blood intoxicant concentration in post-mortem samples harmonizing to Plueckhahn [ 6 ] , who has researched the reading of the blood intoxicant concentration extensively, are: The site of aggregation of the blood sample ; The clip after decease and province of the organic structure when the specimen was collected ; The storage status of the sample, the preservative used, and the clip elapsed before analysis ; The method used for analysis of the sample. Furthermore in add-on to the above, one might besides see the status and visual aspect of the blood sample such as the odor, colour, fluidness and/or the presence of blood fabrics. Despite the fact that blood from a femoral vena is the recommended specimen to be collected for toxicological analysis, some diagnostician still be given to subject cardiac blood or worse fluid scooped from the thorax and or plural pit as a replacement for the appropriate specimen [ 7 ] . This questionable manner of roll uping samples increases the potency for taint of ethyl alcohol entered by the lung due to inspiration of tummy content or ethyl alcohol which might hold diffused from the tummy in to the environing tissue. Blood from the femoral vena is least susceptible to postmortem alterations and as stated earlier the recommended specimen of pick for toxicological analysis. Additionally blood from the interior integral Chamberss of the bosom is besides suited as a auxiliary specimen to compare with femoral blood intoxicant concentration or when there is limited sum of femoral blood available to roll up and/ or analyse [ 8 ] . Furthermore Arterial blood is up to 40 % higher in eth anol concentration during the absorbent stage compared to venous blood, whereas there is undistinguished difference between the two 1s the intoxicant has reached the station optical density stage. Therefore blood from the big vass or bosom may demo differences compared to blood from other beginnings due to incomplete distribution [ 9 ] . This difference was shown by comparing cardiac blood with femoral blood, in which 35 out of 51 instances, had a bosom intoxicant blood was that was by and large higher, with the highest difference observed being 0.09/dL [ 10 ] . Poutry and Anderson [ 11 ] , besides analyzed cardiac and femoral blood in 100 instances, nevertheless, found bosom to femoral ratios being near 0.98. In 17 instances at that place were differences of greater than 20 % between the two in which merely 6 with a bosom to femoral ratio greater than 1. These 6 instances were either in early phases of soaking up or the femoral intoxicant blood degree was unnaturally low due to low volume specimen available in the sample tubing. Harmonizing to this survey circulation equilibrium occurs quickly, which means that differences in blood beginnings occur merely in rare post-mortem instances. This does n't intend that important differences can non happen, particularly in instances affecting possible decomposition, injury a nd in instances of recent consumption when the deceased has been in the soaking up stage and equilibrium has non set in anterior to decease. Because hazard of taint of bosom and upper organic structure blood beginnings, it is recommended to get and analyse blood from a femoral vena [ 2 ] . Some writers even province that the blood straight taken from the chest pit or from a unsighted needle stick into the thorax, is the worst possible sample that can be taken [ 2 ] . The necessary blood intoxicant concentration to do decease is often an unfastened inquiry and depends much on the individual ‘s gender, age, overall wellness, imbibing experience and developed tolerance [ 9 ] .2. Collection and Storage of Specimen for Ethanol Analysis.Among forensic toxicologists and analytical chemists the normally used quoted proverb, that is peculiarly valid in the field of post-mortem forensic toxicology, which emphasizes that right specimen aggregation is the most of import measure in drug analysis is that: â€Å" the analytical consequence will ne'er be better than the sample from which is was derived â€Å" [ 2,6 ] . The intent of roll uping organic structure fluids and executing forensic analytical analysis for ethyl alcohol is to find the significance, if any, of ethyl alcohol in a forensic probe. Not merely the check used to find ethyl alcohol in de samples should be precise, accurate and specific, but the penetrations given should supply information as to whether the measured ethyl alcohol degrees are basically the same as when they were collected [ 5 ] . The concern of possible ethanol loss or addition in clinical or forensic probe at changing times after the specimen was collected is an inevitable factor encountered in many instances affecting the finding of ethyl alcohol. Furthermore post-mortem samples present an extra challenge: does the measured ethanol concentration reflect the concentration at the clip the deceased passed? There are several factors that play a important function in replying these inquiries. In this paragraph the principle and processs for properly aggregation and cont inuing post-mortem specimen will be discussed and categorized in three bomber bunchs ; 1.The loss of ethyl alcohol, 2.The production ethyl alcohol and last but non least 3.The saving of the gathered specimen for ethanol analysis.2.1 The loss of EthanolThe loss of ethyl alcohol from collected specimen has been a concern and a ground for probe for most of the history of forensic toxicology. To day of the month, three major theories are used to explicate the loss of ethyl alcohol from the gathered biological specimen. These include 1. Vaporization, 2. Oxidation and 3. The action of micro-organisms.A. Vaporization

Thomas Jefferson

As stated in the instructions at a lower place the navigation link, Papers/ Projects, a diachronic handleness Is to compare/contrast deuce historic casefuls. You should choose dickens historical events In which you compare and contrast cardinal important historical events such as two battles, two laws, two presidential administrations, etc. You should begin on this designation as soon as possible. This designation is very important and is worth ccc points You moldiness table your historical relation no later than OCTOBER 19thThis grant Is worth a total of three hundred plants It Is payable no later than the buy the farm day of class Please submit your historical Analogy to the instructor, using the here is a detailed description of what a historic Analogy is for the purposes of this course Historical Analogies are proves that compare/contrast two or more historical events, issues, and/or musical themes. Analogies armed service to increase understanding by deali ng with relationships and comparisons the new to the old, the unknown to the known.That is, analogies help us to understand unfamiliar motifs, things, and situations by showing how these matters are similar to something we already know. The instructions below should give you an theme of what the skeleton of a historical similarity essay might look like You would redeem a brief ingress that states your thesis (central Idea, whatever however you well-educated It) and previews how your essay go forth be constructed Then you would write the body of your paper You would then colligate it all together with a well-written conclusion.So, the Idea Is to compare/contrast two historical events/issues from the same era, or sensation historical event/less(prenominal)ee from one era with a scalar historical event/lessee from some a nonher(prenominal) era, or a current event with a historical event we hold up read about or discussed. Thus, Historical Analogy assignment is essentially an essay discussing and analyzing what you pee learned In a way that makes history meaningful to us In our present Analogies should be a MINIMUM length of 4 effigy space pages. REMEMBER, this is the marginal. You should go beyond the stripped if you expect to receive higher Han minimum points for this assignment.You must aim AT to the lowest degree three sources OTHER THAN your textbook. You should s remainder your analogy to the instructor via the MESSAGES center (as an attachment). The Dropped can be found under the Tools navigation button. Be sure to cite all sources that you use You must also provide a list of your sources/ references at the end of your paper. This should be the finally page of your paper. This is a must Use the Epistyle and format. Sample Analogy quiz This is an example of an Analogy essay from one of my previous classes.Although his analogy is not as long as four (double spaced typed) pages, this should give you a good idea regarding the style and f orm your essay should take. I hope it is helpful. In this analogy, I get out compare partisan administration of the first unify Gastroenteritis to todays political parties. prior(prenominal) to 1789 there was basically one fellowship in American politics. In more or less 1792 due to differing opinions on the direction the joined Statehood take in terms of commerce, and mess two separate parties began to form. The Federalist troupe headed by Washington, but whose financial policy was circumscribe byAlexander Hamilton, believed that the economic success of the unify States lie in trade, and commercial interests. Their power root was in the New Mistranslated where there was less of an emphasis on agriculture due to poor soil. The Republican party began approximately 1792. Thomas Jefferson, and James Madison became persuade that Hamiltonians policies favored the wealthy commercial interests at the expense of agriculture. Their belief was that Hamilton and the Federalists were bent on forming an aristocratic government in the United States.Although the names contract changed we still have two main political parties in the United States. Today we have the Republican, and the antiauthoritarian parties. As in the late sasss some(prenominal) of our present day parties claim to be the party of the people. Like early politics both of our parties continually blame the other for the problems that our society experiences. In the assess citizens complained when the United Stateside not remain neutral in European politics, and the same holds true today. shortly we are mired in problems in Bosnia, and most U. S. Citizens would probably rather not see our U.S. Troops involved in something we consider not to be our fight. The last thing that I would compare is how our U. S. political science were nasty back in early look at Aaron take away, and Alexander Hamilton. Aaron remove after being thwarted by Hamiltonian his bid for president challenged Hamilton a d uel. withdraw was upset at Hamiltonian Hamiltonians comment that remove was too dangerous, and unfit to hold office. The end result was that Hamiltonian shot and butchered by Burr in this duel. While today our politicians do not shoot each other, they do find other ways to kill ACH other politically.In todays politics no horizon of a public figures private lifetime is exempt from public scrutiny. Our politicians even go as far as to subscribe to private investigators to dig up crap on each other. While I do not have a fix for the evils, and divisiveness that our two party placement brings about, I do think that it does have its redeeming qualities. Having two parties keeps the ruling party semi-honest. With the threat of losing an option should you go against the will of the people, a two party schema allows voters a choice come election time.